GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTA GAAG How many proteins were

Why are carbon dioxide concentrations expected to increase? a carbon dioxide concentrations are expected to increase, because fossil fuel burning is expected to increase b. carbon dioxide concentrations are expected to increase, because of an increase in agriculture. c. carbon dioxide concentrations are expected to increase, because more land will have to be cleared for increasing populations and agricultural use. d. all of the above select the best answer from the choices provided mark this and return save and exit next submit submit