Scenario: Body Systems work together to maintain the entire organisms. The table below portrays data that was taken from a student before and after that student ran a mile. Prompt: Write a scientific explanation (Claim, Evidence, Reasoning) that described the circulatory systems response to a student running a mile.

During a fierce storm a large number of tall trees on an island are uprooted by the wind and die. most of the trees on the island are now short trees and produce seeds that grow into short trees. what concept is shown in this example? question 5 options: natural selection artificial selection genetic engineering gene splicing

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Which of the following can occur to two segments of a population if they are geographically isolated 1.) they can only share some types of genes 2.)both groups most likely become extinct 3.)they find a way to come back together 4.)eventually they become separate species