Below is a partial mRNA sequence. Use it to answer the following questions. 5' - UGGUCGGCGAGAACGAAAGCGC - 3'
Encoded within the partial mRNA sequence is a region of the protein with the amino acid sequence (N-term...G-E-N-E-S...C-term).
What is the correct reading frame for this mRNA? (Note that the reading frame may not begin with the first base in the partial sequence. It may be necessary to view codons further downstream to find the amino acid sequence N-term...G-E-N-E-S...C-term.)
1. 5' - U | GGU | CGG | CGA | GAA | CGA | AAG | CGC | - 3'
2. 5' - | UGG | UCG | GCG | AGA | ACG | AAA | GCG | C - 3'
3. 5' - UG | GUC | GGC | GAG | AAC | GAA | AGC | GC - 3'
4. 5' - UGGU | CGGC | GAGA | ACGA | AAGC | GC - 3'

Which table best shows the impacts resulting from human activity? impact of human activities human activity impact forest area cleared to construct an airport increase in oxygen level vegetation cleared to construct an oil mine increase in pollution impact of human activities human activity impact forest area cleared to construct an airport increase in sound pollution vegetation cleared to construct a power plant contamination of water impact of human activities human activity impact beehives cleared from urban areas increase in vegetation dams constructed on a river increase in fish population impact of human activities human activity impact beehives cleared from urban areas increase in bird population dams constructed on a river better quality of water

Using the periodic table, determine which material is most likely a good conductor

Amap's orientation is typically determined by an