subject
Biology, 26.10.2020 18:50 jdiel14

In your own words, what is a limiting factor? And explain how limiting factors affect populations.

ansver
Answers: 2

Other questions on the subject: Biology

image
Biology, 22.06.2019 02:00, ozzy1146
Despite the differences in mature plant cells, all of them are derived from meristem cells. the three major types of tissue systems develop from the meristem. meristems develop cells in all but which tissue?
Answers: 3
image
Biology, 22.06.2019 10:30, scott5315
Most enzyme names end in the
Answers: 2
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
image
Biology, 22.06.2019 13:00, joshvslogic341
Dna, in the nucleus carries the genetic code for making proteins in ribosomes. in the diagram, b, represents the proteins produced. dna cannot leave the nucleus to carry the genetic information to the ribosome where proteins are produced. how does the genetic code get from the nucleus to the ribosome? what does a represent? now
Answers: 1
You know the right answer?
In your own words, what is a limiting factor? And explain how limiting factors affect populations....

Questions in other subjects: