The Same building blocks of DNA can be found in all living things
T or F...
Answers: 1
Biology, 22.06.2019 02:30, 10033636
Acertain species of fish can have either long or short fins. the allele for long fins is dominant over the allele for short fins. a heterozygous, long-finned fish is crossed with a homozygous, short-finned fish. of the offspring, will have long fins and be , and will have short fins and be .
Answers: 2
Biology, 22.06.2019 05:00, SmartScholar4094
Idon’t know the answer and i’ve been stuck on it for a while now skskskskks
Answers: 1
Biology, 22.06.2019 11:00, jessicap7pg75
Which skeletal system is represented by the shaded portion of the skeleton? spongy skeleton compact skeleton axial skeleton appendicular skeleton
Answers: 2
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
SAT, 19.01.2022 17:30
Social Studies, 19.01.2022 17:30