The restriction onzyme EcoR1 recognizes the sequence: CATTO OTTAAG And outs the DNA botwoon the and the A on both strands. How many restriction sites are there in the following sequence? ATTOTTOMTTCOTATTGAATTCCO TACACTTAGCATAATTAAGGG
1)none
2)one
3)not enough information
4)three
5)two.

In an experiment examining the effects tai chi on arthritis pain, callahan (2010) selected a large sample of individuals with doctor-diagnosed arthritis. half of the participants immediately began a tai chi course and the other half (the control group) waited 8 weeks before beginning. at the end of 8 weeks, the individuals who had experienced tai chi had less arthritis pain that those who had not participated in the course.

Which of the following is an eon in the time scale? phanerozoic proterozoic archean all of the above

Which topic is most likely to be studied by bo which topic is most likely to be studied by botanist? insect metamorphosis, viral infection, plant growth, animal physiology