Data Table 4: Diffusion Rates 5 minutes in vinegar:
Length of side:
10 mm (1cm)
20 mm (2cm)
30 mm (3cm)

The chart asks for “Distance Vinegar Diffused” and “Diffusion Rate (mm/minute)”

If you have this same assignment, please help. I’m in K-12.

Will mark branliest. the theory of plate tectonics was developed with the contribution of scientists from many different disciplines. which of the following is a contribution from geophysicists?

Humans are believed to have evolved in coastal regions in east africa. the region had an abundant supply of fish for early humanoids to eat. when scientists analyze the fads gene they see an interesting pattern. people whose families have lived in this area of east africa for generation show a high level of diversity in alleles for the fads gene. conversely, people whose families had migrated inland a moderate distance from sources of fish showed a much lower diversity for fads gene alleles. additionally, the fads alleles found in people whose family has lived inland for generation are almost all gene alleles which produce fads proteins with a high level of function and activity. how do anthropologists explain this?

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?