Hep pl
In an mRNA sequence in the following order:
CGUAUGGGCUUACUAGUCUAAC
A: What is the...
Biology, 19.10.2020 08:01 natiem1803
Hep pl
In an mRNA sequence in the following order:
CGUAUGGGCUUACUAGUCUAAC
A: What is the first anticodon to enter the P position?
B. What is the first anticodon to enter position A?
C_ What is the last codon that enters the P position?
Answers: 1
Biology, 22.06.2019 00:00, tylerchitwood211
The table below shows the number of foot bones in some horse fossils. horse fossil recordhorse fossil number of foot bonesp 19q 17r 24s 13ancient horses had more bones in their foot then present-day horses. the present-day horse has 11 foot bones. what is the correct order of evolution of the horse starting from the youngest fossil? a. q p r s b. s r p q c. s q p r d. r p q s
Answers: 3
Biology, 22.06.2019 00:40, cselder
There is a liquid capsule inside a cup full of liquid. the cup full of liquid has salt in it and the liquid capsule has no salt in it. in which direction will the solvent flow? a. the salt does not have to move b. from the capsule to the larger cup c. equally between the capsule and the cup d. from the larger cup to the capsule
Answers: 1
Biology, 22.06.2019 02:30, florochoa217
Plz ! a scientist wants to produce a cow that makes a particular human protein in it’s milk the desired protein causes blood to clot and can be used to treat hemophilia (a blood clotting disorder). which of the following would be best for the scientist to use? a. genetic crosses. b. cloning. c. selective breeding. d. genetic engineering.
Answers: 1
Biology, 22.06.2019 03:30, sCoTtYbOy5329
What organelle other than the nucleus houses dna in a eukaryotic cell?
Answers: 1
History, 26.04.2020 11:42
Mathematics, 26.04.2020 11:42