Biology, 19.10.2020 08:01 kyandrewilliams1

MAY give brainliest! Please give answer and explain:

This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.

ATTTGCATACTACCGGGC

The letters in bold with a yellow highlight are the noncoding region, and the other letters are the protein coding region.

Group of answer choices

ATTTGCAATACTACCGGGC

ATGAATGCATACTACCGGGC

ATTTGCATACTGACCGGGC

ATTTGCAACTACCGGGC

ATTAGCATACTACGGGC

Answers: 1

Show answers

Other questions on the subject: Biology

Biology, 21.06.2019 19:40, TimaGarcia

What feature of cell theory is best demonstrated in the image

Answers: 1

continue

Biology, 21.06.2019 23:50, jennamae9826

Which statement about the immune system is false? a. lymphocytes reduce inflammation, b. b cells remember specific pathogens. c. most white blood cells kill bacteria d. white blood cells are made in lymph nodes.

Answers: 1

continue

Biology, 22.06.2019 01:30, mistiehaas

Compare the composition of the moon's surface with the composition of the earth's surface.

Answers: 2

continue

Biology, 22.06.2019 05:20, kay3940

The large increase in atmospheric carbon dioxide in the last 50 years most likely comes from a. an increase in cellular respiration b. increased decomposition by bacteria c. an increase in the burning of fossil fuels d. an increase in photosynthesis

Answers: 3

continue

You know the right answer?

*MAY* give brainliest! Please give answer and explain:

This sequence encodes for a par...