Biology, 19.10.2020 08:01 kyandrewilliams1

MAY give brainliest! Please give answer and explain:

This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.

ATTTGCATACTACCGGGC

The letters in bold with a yellow highlight are the noncoding region, and the other letters are the protein coding region.

Group of answer choices

ATTTGCAATACTACCGGGC

ATGAATGCATACTACCGGGC

ATTTGCATACTGACCGGGC

ATTTGCAACTACCGGGC

ATTAGCATACTACGGGC

Answers: 1

Show answers

Other questions on the subject: Biology

Biology, 21.06.2019 18:30, smarcalli5194

The graph shows the solubility of several different salts in water, across a range of temperatures. according to the graph, which salt can dissolve at a concentration of about 60 g/100 cm3 of water at 40 degrees celsius?

Answers: 1

continue

Biology, 22.06.2019 01:30, HaileyChristiansen20

Plz ! ive been stuck on this forever

Answers: 1

continue

Biology, 22.06.2019 02:00, emurray

Which best describes what you will do in the reaching your academic potential course?

Answers: 2

continue

Biology, 22.06.2019 06:00, reneethacker20p8wdgn

One function of the immune system is to attack the foreign cells to protect the body. in organ translate , the body recongnizes that the new organ is made of foreign cells. wha kind of medicine would you give a patient to increase the chances of transplate success

Answers: 1

continue

You know the right answer?

*MAY* give brainliest! Please give answer and explain:

This sequence encodes for a par...