subject
Biology, 18.10.2020 08:01 clipsyden

Why doesn't all of the energy available in primary producers
transfer up the food chain?

ansver
Answers: 3

Other questions on the subject: Biology

image
Biology, 22.06.2019 08:30, victory08
What does polymerase chain reaction (pcr) do? o a. separates dna fragments by size o b. cuts a dna sample into fragments o c. provides an overall picture of a person's chromosomes o d. makes more copies of a sample of dna
Answers: 2
image
Biology, 22.06.2019 10:50, luisannavasquez6129
Up to what percentage of the world's flora consisted of cycads during the triassic period? 100% 75% 50% 20%
Answers: 2
image
Biology, 22.06.2019 11:30, yarrito20011307
Which of the following statements is true about the relationship between genetic variation and natural selection? a. genetic variation must be present in a population before natural selection can act on it. b. genetic variation arises in a population as a result of natural selection. c. natural selection can act on a population whether there is genetic variation within the population or not. d. after natural selection acts on a population, the amount of genetic variation in the population always increases.
Answers: 1
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Why doesn't all of the energy available in primary producers
transfer up the food chain?...

Questions in other subjects:

Konu
Mathematics, 01.12.2021 01:00
Konu
Arts, 01.12.2021 01:00
Konu
Biology, 01.12.2021 01:00