![subject](/tpl/images/cats/biologiya.png)
Biology, 12.10.2020 15:01 mallorybranham
before DNA was discovered, in which materials did scientists think the gentic material was stored? a. proteins b. carbohydrates, c. nucleic acids, d lipids
![ansver](/tpl/images/cats/User.png)
Answers: 2
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Other questions on the subject: Biology
![image](/tpl/images/cats/biologiya.png)
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 13:00, Brooke7644
In trying to determine whether dna or protein is the genetic material, hershey and chase made use of which of the following facts? a) dna contains sulfur, whereas protein does not. b) dna contains phosphorus, whereas protein does not. c) dna contains nitrogen, whereas protein does not. d) dna contains purines, whereas protein includes pyrimidines.
Answers: 3
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 13:10, mroueh21
Once an egg cell is fertilized by sperm, the cell then, as the embryo develops, it receives nourishment and eliminates wastes by transferring substances from its blood to its mother's blood. a. becomes a fetus immediately and exits the womb b. begins to divide and implants itself in the wall of the uterus c. remains in the uterus without dividing for several months d. travels back to the ovaries until the fetus is developed
Answers: 2
You know the right answer?
before DNA was discovered, in which materials did scientists think the gentic material was stored? a...
Questions in other subjects:
![Konu](/tpl/images/cats/mir.png)
World Languages, 29.01.2020 11:44
![Konu](/tpl/images/cats/en.png)
English, 29.01.2020 11:44
![Konu](/tpl/images/cats/geografiya.png)
Geography, 29.01.2020 11:44
![Konu](/tpl/images/cats/mir.png)
![Konu](/tpl/images/cats/fizika.png)
Physics, 29.01.2020 11:44
![Konu](/tpl/images/cats/health.png)
![Konu](/tpl/images/cats/istoriya.png)
History, 29.01.2020 11:44
![Konu](/tpl/images/cats/istoriya.png)
![Konu](/tpl/images/cats/obshestvoznanie.png)
![Konu](/tpl/images/cats/mat.png)
Mathematics, 29.01.2020 11:44