What do organisms depend on the coral reef for? Check all that apply.
.
shelter
ebo...<...
Biology, 06.10.2020 22:01 quetzaliescalona
What do organisms depend on the coral reef for? Check all that apply.
.
shelter
ebo...
Cabrigo)
predation
(depredacion)
microhabitat
(microhábitat)
sunlight
Cluz del sol)
Answers: 2
Biology, 22.06.2019 06:20, rosie20052019
What makes a dominant allele different from a recessive allele
Answers: 2
Biology, 22.06.2019 09:30, michellemonroe012305
How energy flows through each level in this energy pyramid. is all the matter and energy from one level transferred to the next level?
Answers: 1
Biology, 22.06.2019 11:30, pacoburden02
Explain the process that creates the heat of the sun?
Answers: 2
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Mathematics, 09.09.2021 21:10
English, 09.09.2021 21:10
History, 09.09.2021 21:10
Mathematics, 09.09.2021 21:10
History, 09.09.2021 21:10
Social Studies, 09.09.2021 21:10