Biology, 05.10.2020 17:01 tmrodriguez1
What are Lipids? Please Help.
Answers: 1
Biology, 21.06.2019 19:30, popt9710
Aflashlight produces light using energy from the batteries. in which order does the energy change form? a. from chemical to electric to light energy b. from electric to light to chemical energy c. from electric to chemical to light energy d. from light to electric to chemical energy
Answers: 3
Biology, 22.06.2019 07:20, boo8181
Agroup of plant cells was exposed to radiation, which damaged the chloroplasts and caused them to lose function. if the mitochondria were unharmed, what would happen to the overall function of the plant cells? a. the cells would not be able to make food, but would be able to release energy from biomolecules. b. the cells would not be able to replicate dna, but would be able to break down waste. c. the cells would not be able to break down waste, but would be able to replicate dna. d. the cells would not be able to release energy from biomolecules, but would be able to make food.
Answers: 1
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 13:00, mimivenga
Astudy by solloch and et. al., in 2017, gives the map above which shows the frequency of alleles with a ccr5-delta32 mutations over 87 different countries. this mutation deletes the presence of a co-receptor (ccr5) on the outside of human t-cells (lymphocytes). some viruses, such as the one responsible for the black death and human immunodeficiency virus (hiv), require this receptor for attachment to host cells during the infection process. the black death was an epidemic that passed over northern europe during the 14th century killing nearly 60% of europeans. according to this information, which explanation best explains why northern europeans show a greater immunity for hiv than some other parts of the world?
Answers: 1
What are Lipids? Please Help....
Biology, 31.08.2021 17:20
Biology, 31.08.2021 17:20
Mathematics, 31.08.2021 17:20
English, 31.08.2021 17:20
Mathematics, 31.08.2021 17:20
Physics, 31.08.2021 17:20