Biology, 04.10.2020 18:01 kayliebug2003

A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?

Answers: 2

Show answers

Answers

Answer from: luiscortes011001

TAAGCCGATAAATGCTAACGGTA

Explanation:

A pairs with T

G pairs with C

vise versa

Answer from: Quest

the menstrual cycle – higher tier. negative feedback mechanisms affect the production of hormones in the menstrual cycle. oestrogen also stimulates the release of lh (luteinising hormone) from the pituitary gland, which in turn controls the production of progesterone.

Answer from: Quest

picture a world where computers are building made-to-order personalized robotic arms and synthetic organs, drones are circulating above mars! due to the rapid growth of technology, the future has never been more unpredictable, and it presents a huge challenge in education: we are teaching students how to work in a future that we have never been unsure of. it is widely predicted that in eight years’ time, there will be more jobs in the fields of science, mathematics, technology and engineering than in any other discipline. and, as the technology continues to develop, it will soon become clear that addressing social problems will involve more innovative thinking, and analytical and technical knowledge than ever before. undeniably, there are no subjects that encourage innovative and creative thinking, deep thought, problem solving and independence more than the stem subjects. while it is widely commented on that there is a need to reimagine the ways stem subjects are taught in schools by embracing a more interactive and innovative approach to appeal to more students, it should come as no surprise that some of the most reputable educational organizations in the world are already implementing changes to embrace stem. harvard, for example, announced in 2014 that they were increasing their computer science faculty by over 50% and has since introduced computer science as a core subject for all freshmen. the urgency of supporting stem subjects at a young age is becoming more relevant than ever, as adopting a keen interest in the curricula needs to happen early. however, beyond the age issue is one of gender.

let me know if you need more

Other questions on the subject: Biology

Biology, 21.06.2019 18:40, 8343244

List two new traits (structural or behavioral) that each new species of rat might demonstrate as it adapts to the conditions on two of the four islands. choose only two islands that are described in the lesson. record the island latter and the major habitat feature of the island. then list two new traits each rat subspecies might demonstrate in order to survive the habitat on that island. note: new traits should be unique to that island and be in response to that island’s habitat feature. i cannot remember islands that were names in the lesson so only answer if you have done the lesson (5.13 life science 7b) choose 2 of the islands and describe a structural and a behavioral trait for a rat on each island so 4 total answers, 2 different structurals and 2 different behaviorals, one for each rat for each island

Answers: 3

continue

Biology, 21.06.2019 22:00, ericavasquez824

What field of science did harry hess study?

Answers: 1

continue

Biology, 21.06.2019 22:20, molinaemily009

Which best describes how the common cold spreads in the human body? a bacteria burst out of normal cells killing them b viruses replicate inside respiratory cells c bacteria inject dna into normal cells d viruses insert dna into bacteria

Answers: 1

continue

Biology, 21.06.2019 23:00, gthif6088

The tasmanian devil, a marsupial carnivore, is facing extinction due to devil facial tumor disease (dftd) which causes bulging cancerous lumps and lesions to erupt around the face and neck — often causing enough deformation to make seeing or eating difficult. dftd has evolved into a contagious cancer, a trait that is unique among cancers. devil mating behavior involves biting around the head and neck, allowing cells from one individual — especially cells from the crumbly dftd tumors — to be transferred to the wounds or face of a new individual. this marsupial was once found across australia, but sea levels rose, isolating the tasmanian population, while the australian population went extinct. what would be an outcome of genetic isolation that is likely to have impacted the spread of dftd? a) reduced territory puts diseased individuals in greater contact with non-diseased ones. b) inbreeding results in less variation in facial features so the cancer is generally fatal. c) genetic isolation has made it difficult for scientists to develop a vaccine against dftd. d) the lack of genetic variation in the immune system of tasmanian devils minimizes resistance to the disease.