Biology, 04.10.2020 18:01 kayliebug2003
A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
Answers: 2
Biology, 22.06.2019 04:40, adrianna2324
Awoman whose sister tested positive for a specific mutation in the brca1 gene, which increases the risk for breast and ovarian cancer, is found not to have that mutation but does have a mutation of unknown significance near the known mutation site. how should this woman be counseled? select one: a. she should be informed that her risk for breast cancer is greater than the general population but not as great as her sister’s risk. b. she should be informed that because she does not have the mutation, her risk for breast cancer is not greater than that of the general population. c. she should be informed of her gene mutation status and be presented with all the available prophylaxis options and reconstruction options. d. she should be informed that she does not have the specific mutation but that because another mutation is present she should be vigilant about screening
Answers: 1
A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?...
Mathematics, 17.10.2019 21:30
Geography, 17.10.2019 21:30
Mathematics, 17.10.2019 21:30
Mathematics, 17.10.2019 21:30
Chemistry, 17.10.2019 21:30