![subject](/tpl/images/cats/biologiya.png)
Biology, 04.10.2020 18:01 kayliebug2003
A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
![ansver](/tpl/images/cats/User.png)
Answers: 2
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Other questions on the subject: Biology
![image](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 23:30, chonawilson4
What is the importantence of the carbon and nitretan cycles in the environment
Answers: 1
![image](/tpl/images/cats/biologiya.png)
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00, princessmoon
Which of the following is not associated with invasive species?
Answers: 1
You know the right answer?
A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?...
Questions in other subjects:
![Konu](/tpl/images/cats/istoriya.png)
History, 19.11.2020 05:20
![Konu](/tpl/images/cats/biologiya.png)
Biology, 19.11.2020 05:20
![Konu](/tpl/images/cats/health.png)
![Konu](/tpl/images/cats/istoriya.png)
![Konu](/tpl/images/cats/geografiya.png)
Geography, 19.11.2020 05:20
![Konu](/tpl/images/cats/mat.png)
Mathematics, 19.11.2020 05:20
![Konu](/tpl/images/cats/mat.png)
Mathematics, 19.11.2020 05:20
![Konu](/tpl/images/cats/mat.png)
Mathematics, 19.11.2020 05:20
![Konu](/tpl/images/cats/mat.png)
Mathematics, 19.11.2020 05:20