subject
Biology, 04.10.2020 18:01 kayliebug2003

A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?

ansver
Answers: 2

Other questions on the subject: Biology

image
Biology, 21.06.2019 18:40, 8343244
List two new traits (structural or behavioral) that each new species of rat might demonstrate as it adapts to the conditions on two of the four islands. choose only two islands that are described in the lesson. record the island latter and the major habitat feature of the island. then list two new traits each rat subspecies might demonstrate in order to survive the habitat on that island. note: new traits should be unique to that island and be in response to that island’s habitat feature. i cannot remember islands that were names in the lesson so only answer if you have done the lesson (5.13 life science 7b) choose 2 of the islands and describe a structural and a behavioral trait for a rat on each island so 4 total answers, 2 different structurals and 2 different behaviorals, one for each rat for each island
Answers: 3
image
Biology, 21.06.2019 22:00, ericavasquez824
What field of science did harry hess study?
Answers: 1
image
Biology, 21.06.2019 22:20, molinaemily009
Which best describes how the common cold spreads in the human body? a bacteria burst out of normal cells killing them b viruses replicate inside respiratory cells c bacteria inject dna into normal cells d viruses insert dna into bacteria
Answers: 1
image
Biology, 21.06.2019 23:00, gthif6088
The tasmanian devil, a marsupial carnivore, is facing extinction due to devil facial tumor disease (dftd) which causes bulging cancerous lumps and lesions to erupt around the face and neck — often causing enough deformation to make seeing or eating difficult. dftd has evolved into a contagious cancer, a trait that is unique among cancers. devil mating behavior involves biting around the head and neck, allowing cells from one individual — especially cells from the crumbly dftd tumors — to be transferred to the wounds or face of a new individual. this marsupial was once found across australia, but sea levels rose, isolating the tasmanian population, while the australian population went extinct. what would be an outcome of genetic isolation that is likely to have impacted the spread of dftd? a) reduced territory puts diseased individuals in greater contact with non-diseased ones. b) inbreeding results in less variation in facial features so the cancer is generally fatal. c) genetic isolation has made it difficult for scientists to develop a vaccine against dftd. d) the lack of genetic variation in the immune system of tasmanian devils minimizes resistance to the disease.
Answers: 3
You know the right answer?
A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?...

Questions in other subjects:

Konu
English, 05.02.2021 23:10
Konu
Mathematics, 05.02.2021 23:10
Konu
Mathematics, 05.02.2021 23:10
Konu
Mathematics, 05.02.2021 23:10