subject
Biology, 04.10.2020 18:01 kayliebug2003

A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?

ansver
Answers: 2

Other questions on the subject: Biology

image
Biology, 21.06.2019 21:20, lorielle
How is mitosis different in plants and animals? a. in animals, the cell membrane pinches together. b. in plants, the dna is one circular chromosomes. c. in plants, there are no sister chromatids. d. in animals, a new cell wall forms.
Answers: 2
image
Biology, 22.06.2019 03:00, genaro19
The diagram shows the layers of earth. convection currents in which region influence the movement of tectonic plates
Answers: 1
image
Biology, 22.06.2019 04:40, adrianna2324
Awoman whose sister tested positive for a specific mutation in the brca1 gene, which increases the risk for breast and ovarian cancer, is found not to have that mutation but does have a mutation of unknown significance near the known mutation site. how should this woman be counseled? select one: a. she should be informed that her risk for breast cancer is greater than the general population but not as great as her sister’s risk. b. she should be informed that because she does not have the mutation, her risk for breast cancer is not greater than that of the general population. c. she should be informed of her gene mutation status and be presented with all the available prophylaxis options and reconstruction options. d. she should be informed that she does not have the specific mutation but that because another mutation is present she should be vigilant about screening
Answers: 1
image
Biology, 22.06.2019 12:30, kenziechalkprincess2
Due tonight 10 points will mark brain
Answers: 1
You know the right answer?
A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?...

Questions in other subjects:

Konu
Mathematics, 17.10.2019 21:30