subject
Biology, 24.09.2020 15:01 haileysolis5

THIS IS CRAZ!1.What are some of the structures inside a cell that help it to live and perform its role in an organism? 2.How do you think plant cells differ from animal cells? (Hint: What can plants do that animals cannot?) Gizmo Warm-upThe Cell Structure Gizmo allows you to look at typical animaland plant cells under a microscope. On the ANIMAL CELL tab, click Sample to take a sample of an animal cell. Use theZoom slider to see the cell at a magnification of 2000x (2000times larger than normal). On the dropdown menu, select Centrioles.1.Use the up/down and left/right sliders to manipulate the cell. Find the red arrow pointing to the centrioles. Make a sketch of the centrioles in the space below.2.Read the description of the centrioles. What is their function? 2018Activity A: Animal cellsGet the Gizmo ready:Check that an Animal cell is mounted on the microscope.Check that the Zoom is set to 2000x. Question: Organelles are specialized structures that perform various functions in the cell. What are the functions of the organelles in an animal cell?1.Label: Locate each organelle in the animal cell. Label the organelles in the diagram below.2.Match: Read about each organelle. Then match each organelle to its function/description. Cytoplasm Lysosome Mitochondria Centriole Endoplasmic reticulum Vacuole Cell membrane Nucleus Ribosome Nuclear membrane Golgi apparatus Vesicle NucleolusA. Structure that organizes motion of chromosomes. B.Stack of membranes that packages chemicals. C.Membrane that protects the nucleus. D.Membrane that surrounds and protects the cell. E.Sac filled with digestive chemicals. F.Structures that converts nutrients to energy. G.Passageways where chemicals are made. H.Jelly-like substance within the cell membrane. I.Structure that manufactures ribosomes. J.Structure that contains DNA and regulates genes. K. Package created by the Golgi apparatus. L.Small structure that synthesizes proteins. M.Sac that stores water, nutrients, or waste products.

2018Activity B: Plant cellsGet the Gizmo ready:Select the PLANT CELL tab, and click Sample.Set the Zoom to 2000x. Question: What functions do the organelles in a plant cell perform?1.Label: Locate each organelle in the plant cell. Label the organelles in the diagram below.2.Compare: What structures are present in an animal cell, but not in a plant cell? What structures are present in a plant cell, but not in an animal cell? 3.Fill in: Name the organelle or organelles that perform each of the following functions. A. convert sunlight to chemical energy. B. The and the help to support the plant cell and help it to maintain its shape. C. store food or pigments. D.The converts food into energy. It is found in both plant

ansver
Answers: 3

Other questions on the subject: Biology

image
Biology, 22.06.2019 01:20, hannahpelkey
Which organelles are labeled d, and what is one feature that distinguishes them from the other labeled organelles chloroplasts the only organelles that produce sugars from sunlight mosomes, only found in animal and bacterial cells centricles only found in animal cells mitochondra, the only energo-generating structures found in cells
Answers: 1
image
Biology, 22.06.2019 05:30, coolcat3190
How does the nervous system affect the excretory system?
Answers: 1
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
image
Biology, 22.06.2019 12:00, brookesquibbs
How long does it take a skateboarder going 6.0 m/s to come to a complete stop if she slows down at a rate of 2.0 m/s^2
Answers: 1
You know the right answer?
THIS IS CRAZ!1.What are some of the structures inside a cell that help it to live and perform its ro...

Questions in other subjects:

Konu
Mathematics, 11.10.2019 12:50
Konu
Mathematics, 11.10.2019 12:50