Every Friday Jane uses a special disinfectant to clean the exam rooms. She used the last bottle last Friday and the order for a new bottle has not arrived. The only cleaner she can find says “For Use in Outdoor Kennels Only”. Should Jane use the cleaner? Why or why not
Answers: 2
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 14:20, makaylahunt
Which of the following is most likely the result of an organism having lipids in its body a) water cannot be absorbed through the surface of a leaf b)human eats fruits to get a quick source of energy c) a sheep sleeps for more hours in the winter d) a warm river is filled with fish and algae
Answers: 1
Biology, 22.06.2019 21:00, asmita9876
Which claim correctly describes how genes can produce a phenotype? one gene is responsible for all traits. each trait is determined by a single gene. one gene can be responsible for many traits. each gene is responsible for exactly one trait.
Answers: 2
Biology, 23.06.2019 01:30, gaelm735
Maria wanted to grow a fern in her backyard. acting on a suggestion from a friend, she collected brown dots from the underside of a fern’s leaves and then potted them. after a few days, maria saw small fern leaves erupting from the pot. which statement explains this phenomenon?
Answers: 2
Every Friday Jane uses a special disinfectant to clean the exam rooms. She used the last bottle last...
Mathematics, 21.07.2019 00:30
Mathematics, 21.07.2019 00:30
Mathematics, 21.07.2019 00:30
Social Studies, 21.07.2019 00:30
Mathematics, 21.07.2019 00:30