Biology, 06.09.2020 08:01 mandy9386

Scientist 1 specializes in studying humans and their interactions with other humans without attention to other living things or the non-living environment that they live in Scientist 2 studies single celled organisms that keep their DNA inside of a compartment in their one cell and their interactions with all of the other living things in pond water but
without regard to the non-living things in and around the pond
Which of the following is true about the scientists studies?
O A Scientist 1 studies protists in ecosystems and Scientist #2 studies fungi in the biosphere
OB Scientist #1 studies animals in communities and Scientist #2 studies plants in ecosystems
OC Scientist 1 studies bacteria in tissues and Scientist 2 studies protists in ecosystems
OD Scientist studies animals in populations and Scientist #2 studies protists in communities
O E Scientist #1 studies protists in populations and Scientist #2 studies bacteria in communities

Answers: 2

Show answers

Other questions on the subject: Biology

Biology, 22.06.2019 06:30, unknown6669

Is there any solid scientific evidence that humans have been cloned?

Answers: 1

continue

Biology, 22.06.2019 09:00, Ciarrathereal

Toorale man murder mystery < - your lab link 1. how was the toorale man found? 2. what did archaeologists learn about the burial? why is the burial important? 3. what information were the scientists able to learn from the skeleton itself? 4. why is the question of whether the injuries came from a stone or steel weapon important? how could scientists distinguish between the different types of weapons? 5. what did the carbon dating and soil testing tell scientists about toorale man? why are the dates interesting for scientists?

Answers: 3

continue

Biology, 22.06.2019 11:30, alyssahomeworkneeds

Graded assignment lab report answer the questions below. which combinations of substances resulted in a chemical change? for each metal that participated in a chemical change, write the type of metal it is, based on your examination of the periodic table. were there any metallic compounds that did not react with either the acid or the base? write the type of metal, based on your examination of the periodic table. make a general statement about the reactivity of the metals in this experiment.

Answers: 1

continue

Biology, 22.06.2019 12:00, jose200144

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Answers: 1

continue

You know the right answer?

Scientist 1 specializes in studying humans and their interactions with other humans without attentio...