Carbon is unique due to the carbon atom's Ob
bonding properties.
six outer unpaired electrons.
ionic compounds.
hydrogen bonding strength.
C
Od
can someone please answer this

The pharynx is the structure in the body that serves as a pathway of both air and food. how does the body make sure that food does not get into the lungs? the salivary glands secrete enzymes that pull food out of the air pathway. the small intestine pushes the air out of the digestive system. the pancreas breaks down food in the air pathway. the epiglottis closes the air pathway so that food will not enter it.

The relationship between intron and exon

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?