Biology, 21.08.2020 01:01 darkghostmist
What is The mutation caused by the addition of a nucleotide to an already existing gene sequence called? A. deletion B. duplication C. insertion D. Inversion ??
Answers: 1
Biology, 21.06.2019 23:10, ExperimentsDIYS
(drag each tile to the correct location.) categorize each term as something that is typical of a scientific theory, a scientific hypothesis, or both. - a tentative statement used to guide scientific investigations. - makes predictions about future events. - can be tested by many independent researchers. - based on observations of natural phenomena. - a well-established, highly reliable explanation.
Answers: 1
Biology, 22.06.2019 10:30, nonjabulomabaso7423
Subduction zones form when an oceanic plate collides with another oceanic plate or continental plate. the continental crust is lighter and less dense than oceanic crust. continental crust's density is approximately 2.7 grams per cubic centimeter. oceanic crust is thinner and the average density is about 3.3 cubic centimeters. when the two crustal plates converge the oceanic plate always bends and subducts beneath a continental plate. once the oceanic crust subjects, the rocks are subjected to changes in heat and pressure. because of this, we would expect to find rocks in the area of a subduction. a) clastic b) igneous c) metamorphic d) sedimentary
Answers: 2
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
What is The mutation caused by the addition of a nucleotide to an already existing gene sequence cal...
Social Studies, 15.08.2021 21:00
Mathematics, 15.08.2021 21:00
Mathematics, 15.08.2021 21:00
Mathematics, 15.08.2021 21:00
Engineering, 15.08.2021 21:00
Mathematics, 15.08.2021 21:00