Biology, 20.08.2019 07:50 gabrielrivasgom
When tagging animals specifically for the study of population size, scientists must do all of the following except: a. tag all individuals during the first study to ensure accurate results b. make sure that markings do not harm the animal c. ensure that tags are non-toxic and will not come off of the animal d. ensure that the location and color of the tag does not draw the attention of predators
Answers: 2
Biology, 22.06.2019 08:10, Haneendye123
In sweet pea, gene c is responsible for color production and gene p is responsible for the purple color pigment. both of them are located on two different loci on different chromosomes. the flowers will be purple only when the plant has the genotypes as c_p_. no color will be produced with genotypes: ccpp, ccpp, ccpp, ccpp. thus, gene c controls the expression of gene p. what pattern of inheritance is exhibited here? a. pleiotropy b. epistasis c. multiple alleles
Answers: 1
Biology, 22.06.2019 10:50, guzmangisselle
Which of the following was not a major animal on land during the carboniferous period? amphibians insects both a and b none of the above
Answers: 1
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
When tagging animals specifically for the study of population size, scientists must do all of the fo...
Health, 25.11.2019 19:31