subject
Biology, 25.06.2020 09:01 alannaamarriee

Assume that the import of a particular amino acid across the plasma membrane is observed (1) to occur only down its concentration gradient and (2) to slow when a different but similar amino acid is added to the extracellular fluid. The movement of the amino acid through the membrane is most likely by

ansver
Answers: 1

Other questions on the subject: Biology

image
Biology, 21.06.2019 22:40, mkingston1705
Which sequence correctly shows the path of carbon dioxide during repiration?
Answers: 1
image
Biology, 22.06.2019 00:10, breasiasamuel7053
Which is an example of a decomposer? a. bear b. algae c. grass d. bacteria d bacteria
Answers: 2
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
image
Biology, 22.06.2019 19:00, milkshakegrande101
Mercury metal is poured into a graduated cylinder that holds exactly 22.5 ml the mercury used to fill the cylinder mass in 306.0 g from this information calculate the density of mercury
Answers: 2
You know the right answer?
Assume that the import of a particular amino acid across the plasma membrane is observed (1) to occu...

Questions in other subjects:

Konu
Social Studies, 01.07.2019 02:00