subject
Biology, 22.06.2020 11:57 noriega16

1. The following sequence was taken from a DNA molecule 5'- AACCTTTAGGGCCCTTTAAA - 3'
Given that the temperature required breaking, one bond in the molecule is 12°C. What is
the total temperature required to completely break the entire DNA molecule.
a 48°C
b. 57.6°C
C. 240°C
d. 480°C
e. 576°C

ansver
Answers: 2

Other questions on the subject: Biology

image
Biology, 21.06.2019 21:00, marialuizavalen
When water freezes, it . contracts expands
Answers: 1
image
Biology, 22.06.2019 02:00, mayhy100
Which blood cell spend most of their time in the lymphatic system?
Answers: 1
image
Biology, 22.06.2019 02:00, mathman783
Bisphenol a (often called bpa) is a chemical found in products that people use every day, from water bottles to food containers to children's toys. unfortunately, bpa leaches out of its many products and makes its way into our bodies. what are the health effects of bpa exposure? ongoing research is finding that elevated exposure to bpa can affect a wide variety of developmental and physiological processes, but one of the first studies of bpa's health effects came about because of a simple mistake in the lab. at a laboratory at case western reserve university in 1998, geneticist patricia hunt was making a routine check of her female lab mice. as she extracted and examined developing eggs from the ovaries, she began to wonder what had gone wrong. she noticed that many of the eggs showed problems with their chromosomes, and some had irregular amounts of genetic material, which can lead to miscarriages and birth defects in mammals. she learned that a lab assistant had mistakenly washed the plastic mouse cages and water bottles with a harsh soap, releasing bpa from the plastic. knowing that bpa is an endocrine disruptor, a chemical that can enter organisms and mimic hormones, hunt set out to discover whether it had adversely affected her mice.
Answers: 2
image
Biology, 22.06.2019 05:40, Student658
Which of these substances does not protect against invaders in the nonspecific immune response? a. saliva b. mucus c. tears d. urine
Answers: 1
You know the right answer?
1. The following sequence was taken from a DNA molecule 5'- AACCTTTAGGGCCCTTTAAA - 3'
Given th...

Questions in other subjects:

Konu
Geography, 10.10.2019 20:00
Konu
Mathematics, 10.10.2019 20:00