Biology, 21.05.2020 21:09 torigirl4126

There are two routes for eliminating solutes from the circulation. The first is , which transfers solutes directly from the blood to the tubular lumen, and the other is , which transfers solutes indirectly, from peritubular capillaries to interstitial fluid and from there through tubular cells into the tubular lumen. The second process primarily moves solutes by active transport and is prevalent in the distal convoluted tubules.

Answers: 1

Show answers

Other questions on the subject: Biology

Biology, 21.06.2019 23:00, reggie1127

Seen in some gram-positive bacilli, occurs when only the inner portion of a cell wall is deposited across the dividing cell. this new cross wall puts tension on the outer layer of the old cell wall. eventually, the outer wall breaks at its weakest point with a snapping movement that tears it most of the way around. the daughter cells can then remain hanging together almost side by side being held by a small remnant of the original outer wall. choose from the following statements the ones that correctly discuss reproduction using binary fission in a bacterial cell. select all that apply. view available hint(s) select all that apply. due to the stretching of the cytoplasmic membrane, both cells will contain a complete genome. each daughter cell will contain an equal number of organelles. the daughter cell will be a permanently smaller copy of the mother cell but will contain a complete genome. each daughter cell is an exact copy of the other, both genetically and morphologically

Answers: 1

continue

Biology, 22.06.2019 01:50, AdoNice

Four different thermometers were used to measure the temperature of a sample of pure boiling water. the measurements are recorded in the table below. thermometer temperature reading 1 temperature reading 2 temperature reading 3 w 100.1°c 99.9°c 96.9°c x 100.4°c 102.3°c 101.4°c y 90.0°c 95.2°c 98.6°c z 90.8°c 90.6°c 90.7°c the actual boiling point of pure water is 100.0°c. what can be concluded from the data about the reliability and validity of the thermometers?

Answers: 1

continue

Biology, 22.06.2019 06:30, poohnia

What molecule does hemoglobin decay into over time

Answers: 1

continue

Biology, 22.06.2019 12:00, jose200144

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Answers: 1

continue

You know the right answer?

There are two routes for eliminating solutes from the circulation. The first is , which transfers so...