subject
Biology, 06.05.2020 21:39 wolfsaway

Ead the article “Lichens Are an Early Warning System for Forest Health,” and then answer the following questions.

Part A
Explain why the forest ecosystem is a system. Use examples from the article to support your explanation.

Font Sizes

ansver
Answers: 2

Other questions on the subject: Biology

image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
image
Biology, 22.06.2019 13:00, blesskids600
This is an active transport mechanism by which cells pump sodium and potassium ions against the concentration gradient
Answers: 1
image
Biology, 22.06.2019 20:30, Meiyuh1
Part of the elbow is formed by the end of the humerus. what do you call this part?
Answers: 1
image
Biology, 22.06.2019 21:40, falishaduncanovmtz2
According to the rna world hypothesis, rna acted as the genetic material and catalyzed reactions in ancient cells. what conclusion can you draw from this?               a.  this implies that dna and proteins aren't essential in cells today.    b.  this implies that rna can catalyze any chemical reaction that enzymes catalyze.    c.  this implies that if a cell has a problem with its dna, its rna can compensate for the damaged dna.    d.  this implies that dna and proteins evolved after rna.
Answers: 2
You know the right answer?
Ead the article “Lichens Are an Early Warning System for Forest Health,” and then answer the followi...

Questions in other subjects:

Konu
History, 07.06.2021 05:30
Konu
Mathematics, 07.06.2021 05:30