![subject](/tpl/images/cats/biologiya.png)
The middle of an mRNA molecule contains the nucleotide sequence shown here. Much more of the mRNA is translated. Assume that the sequence is read from left to right.
AUUUAACUGUUCUGUCUAGAG
1. Use the genetic code to translate the sequence into each of the three possible sets of amino acids.
2. Which of the three sets of amino acids is the most likely to be included in the polypeptide? Explain your reasoning.
![ansver](/tpl/images/cats/User.png)
Answers: 2
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Other questions on the subject: Biology
![image](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 21:30, noahwaitsowl357
Me with these questions if you’re it sure don’t answer
Answers: 2
![image](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 23:40, victoria1831
When coal has reached it hardest, darkest form, it is called select one: 0 a. sub-bituminous b. lignite c. bituminous d. antrhacite next page
Answers: 3
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 04:00, jorgepas66
The tubes transporting minerals and water upward are called ?
Answers: 1
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 09:00, werewolf4751
Which of these is an example of land degradation? a. containers designed to store pollutants leak. b. fertilizers provide too many nutrients to crops. c. garbage is buried so the land can be reclaimed later. d. a drought kills all the plants in an area, leaving bare land
Answers: 3
You know the right answer?
The middle of an mRNA molecule contains the nucleotide sequence shown here. Much more of the mRNA is...
Questions in other subjects:
![Konu](/tpl/images/cats/en.png)
English, 06.05.2021 20:20
![Konu](/tpl/images/cats/istoriya.png)
History, 06.05.2021 20:20
![Konu](/tpl/images/cats/biologiya.png)
Biology, 06.05.2021 20:20
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/mat.png)
Mathematics, 06.05.2021 20:20
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/mat.png)
Mathematics, 06.05.2021 20:20
![Konu](/tpl/images/cats/fizika.png)