Robert is studying a long list of letters. The letters represent the order of nitrogenous bases in a molecule of mRNA. The first several bases in the list are shown below. AUGCCACAGGUUCAUCCGAA… To identify the amino acid sequence encoded by the mRNA, which would be the most useful first step for Robert to follow?

the corpus luteum secretes estrogens and progesterone. the latter hormone causes changes in the uterus that make it more suitable for implantation of the fertilized ovum and the nourishment of the embryo. if the egg is not fertilized, the corpus luteum becomes inactive after 10–14 days, and menstruation occurs.

i hope this : )

picture a world where computers are building made-to-order personalized robotic arms and synthetic organs, drones are circulating above mars! due to the rapid growth of technology, the future has never been more unpredictable, and it presents a huge challenge in education: we are teaching students how to work in a future that we have never been unsure of. it is widely predicted that in eight years’ time, there will be more jobs in the fields of science, mathematics, technology and engineering than in any other discipline. and, as the technology continues to develop, it will soon become clear that addressing social problems will involve more innovative thinking, and analytical and technical knowledge than ever before. undeniably, there are no subjects that encourage innovative and creative thinking, deep thought, problem solving and independence more than the stem subjects. while it is widely commented on that there is a need to reimagine the ways stem subjects are taught in schools by embracing a more interactive and innovative approach to appeal to more students, it should come as no surprise that some of the most reputable educational organizations in the world are already implementing changes to embrace stem. harvard, for example, announced in 2014 that they were increasing their computer science faculty by over 50% and has since introduced computer science as a core subject for all freshmen. the urgency of supporting stem subjects at a young age is becoming more relevant than ever, as adopting a keen interest in the curricula needs to happen early. however, beyond the age issue is one of gender.

let me know if you need more

a. 35°c

b. 25°c

c. 10°c

d. 40°c