Why would a desert ecosystem that is dry and shady support less biodiversity than a sunny forest with frequent rainfall?

Plz genetic engineering can be applied to many fields including medicine and agriculture. which of the following is a medical application of genetic engineering? a. giving crop plants recombinant dna so that they would be resistant to herbicides. b. examining a persons pedigree to determine whether they can carry a gene for a genetic disease. c. analyzing a persons dna to see how closely they are related to another person. d. certain genes into bacteria so that they will produce a needed medicine.

Which of the following produces carbon dioxide? a. plants b. animals c. decomposers d. all of the above

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?