subject
Biology, 17.10.2019 09:01 rosier6244

Brownfields are best described as

a. parcels of polluted land that cannot be redeveloped safelyb. polluted land that must be remediated before being redevelopedc. land where pollution has killed all vegetation, turning it “brown”d. fields with excess organic waste and animal feces

ansver
Answers: 2

Other questions on the subject: Biology

image
Biology, 22.06.2019 10:00, zaikam81
Witch theory suggests all living things are made up of cell or cells
Answers: 1
image
Biology, 22.06.2019 11:30, rockinrachel9099
Which organism can most likely be classifild as domain bateria
Answers: 1
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
image
Biology, 22.06.2019 14:20, Aliyah2020
First idea: suddenly, women were leaving their homes to cycle and socialize on country roads and city streets. —wheels of change, sue macy second idea: it was not a stretch for some cyclists to see the possibility of a larger role for women in the world. —wheels of change, sue macy what type of graphic organizer would best represent the connection between these two ideas? 1) a t-chart that separates ideas into two different categories 2) a chronology that shows 3) a sequence of several events a cause-and-effect graphic that shows how one idea led to another 4)a problem-solution graphic that presents a problem and a solution to the problem
Answers: 2
You know the right answer?
Brownfields are best described as

a. parcels of polluted land that cannot be redeveloped...

Questions in other subjects:

Konu
Mathematics, 29.12.2020 21:30