Biology, 16.04.2020 19:23 russianspartan1
Why are there relatively few errors in dna molecules after dna has been replicated
A. The bonds are so strong that errors are never made
B. Replication enzymes proofread new DNA strand before replication is complete
C. There isn’t much DNA so there are not a lot of chance for error
Answers: 3
Biology, 22.06.2019 05:30, yudayang2012pa9u8p
What is the average speed of a car that traveled 300.0 miles in 5.5 hours
Answers: 1
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 13:00, dogisreallyeggroll
Describe the impact of deforestation of both abiotic and biotic factors within the tropical rainforest.
Answers: 2
Biology, 22.06.2019 19:00, katherineweightman
1. in what ways have non-native species been beneficial? 2. what are some of the hypotheses for the collapse of honeybee colonies? 3. distinguish between regional and functional extinction. 4. why is it difficult to measure background extinction rates? 5. what three factors are most important in causing extinction rates to climb?
Answers: 2
Why are there relatively few errors in dna molecules after dna has been replicated
A. Th...
A. Th...
Mathematics, 17.11.2020 19:20
Mathematics, 17.11.2020 19:20
History, 17.11.2020 19:20
History, 17.11.2020 19:20
Mathematics, 17.11.2020 19:20
Chemistry, 17.11.2020 19:20
Mathematics, 17.11.2020 19:20