During which process is mRNA converted into a sequence of amino acids for protein production?
...
![subject](/tpl/images/cats/biologiya.png)
Biology, 16.04.2020 00:07 kelseypichla
During which process is mRNA converted into a sequence of amino acids for protein production?
transcription
translation
translocation
mRNA synthesis
![ansver](/tpl/images/cats/User.png)
Answers: 2
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Other questions on the subject: Biology
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 06:20, mariap3504
(select all the correct choose each statement that is scientific. - the opinions of randomly selected participants in a survey prove the idea that global temperatures are not increasing on earth. - the universe's average temperature and rate of expansion support the idea that it began as one super-dense and hot mass 13.8 billion years ago. - ocean tides are caused by the uneven gravitational pulls of the moon and sun on different parts of earth. - human life is more valuable than other forms of life on earth because humans are more intelligent than other organisms.
Answers: 3
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![image](/tpl/images/cats/biologiya.png)
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 16:30, dinarussell74
Energy stored in the bonds that hold together the atoms and molecules of all substances is called a. kinetic energy. b. electrical energy. c. mechanical energy. d. chemical energy.
Answers: 1
You know the right answer?
Questions in other subjects:
![Konu](/tpl/images/cats/ekonomika.png)
![Konu](/tpl/images/cats/ekonomika.png)
![Konu](/tpl/images/cats/en.png)
![Konu](/tpl/images/cats/obshestvoznanie.png)
![Konu](/tpl/images/cats/ekonomika.png)
![Konu](/tpl/images/cats/obshestvoznanie.png)
![Konu](/tpl/images/cats/obshestvoznanie.png)
![Konu](/tpl/images/cats/health.png)
![Konu](/tpl/images/cats/mat.png)