Identify the choice that best completes the statement or answers the question. Robert is studying a long list of letters. The letters represent the order of nitrogenous bases in a molecule of mRNA. The first several bases in the list are shown below. AUGCCACAGGUUCAUCCGAA… To identify the amino acid sequence encoded by the mRNA, which would be the most useful first step for Robert to follow?a. Calculate the frequencies of each letter.
b. Count the number of letters in the list.
c. Separate the list into three-letter "words."
d. Separate the list into two-, three- and four-letter "words."

How do cells grow and reproduce to maintain homeostasis?

What enzyme is most important for dna replication and why?

Duchenne muscular dystrophy is a serious condition caused by a recessive allele of a gene on the human x chromosome. the patients have muscles that weaken over time because they have absent or decreased dystrophin, a muscle protein. they rarely live past their twenties. how likely is it for a woman to have this condition? a) women can never have this condition. b) one-fourth of the daughters of an affected man would have this condition. c) one-half of the daughters of an affected father and a carrier mother could have this condition. d) only if a woman is xxx could she have this condition.