Scientists have been investigating a way to recreate extinct species such as the saber-toothed cat illustrated below. Which technique would use DNA from an extinct species to recreate an organism of the species?

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Drag the tiles to the correct boxes to complete the pairs. match each cell organelle with its description.

Astudent completed a lab report. which correctly describes the difference between the “question” and “hypothesis” sections of her report? “question” states what she is asking, and “hypothesis” states the result of her experiment. “question” states what she is asking, and “hypothesis” states what she thinks the answer to that question is in “if . . then . . because” format. “question” describes what she is trying to find out, and "hypothesis" states the procedures and methods of data collection. “question” describes what she is trying to find out, and “hypothesis” states any additional information or prior knowledge about the question.