The central dogma of molecular biology states that DNA is into mRNA, which is then translated into polypeptides. Eukaryotic ribosomes exist freely floating in the and membrane-bound. In peptide synthesis, after an amino acid has been added to the polypeptide chain, the empty exits the ribosome. Respond to the following based on your reading. Where is the ribosome located in the cell? What is the essential role of the ribosome in gene expression? In which crucial step of gene expression does the ribosome play a major role: transcription or translation? How does the ribosome differ in eukaryotes and prokaryotes? Why is transfer RNA, or tRNA, necessary for protein synthesis? What is the role of ribosomal RNA in the ribosome? What happens if there are no ribosomes present in the cell, or if the ribosomes do not function properly?
Answers: 2
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 12:30, salterappraisal5757
The direct energy source that drives atp synthesis during respiratory oxidative phosphorylation is
Answers: 1
Biology, 22.06.2019 13:00, archiecom55
Sequence how oxygen accumulated in the atmosphere and the effect it had on life by completing the flowchart
Answers: 1
The central dogma of molecular biology states that DNA is into mRNA, which is then translated into...
Mathematics, 28.08.2019 20:20
Mathematics, 28.08.2019 20:20
Medicine, 28.08.2019 20:20
English, 28.08.2019 20:20
Physics, 28.08.2019 20:30
Mathematics, 28.08.2019 20:30