Rachel accidentally touches a hot stove and then immediately reacts by removing her hand. Explain what signals are sent both from her hand (when she touches the stove) and then back to her hand (when she removes her hand) and from where they are sent in order for her to react quickly.

Which best describes a benefit of using dna technology in medicine? a) medicine can be produced in mass quantities. b) medicine can be distributed at a reduced cost. c) medicines have fewer side effects. d) medicines are resistant to antibiotics.

Asegment of dna that codes for rna and a protein is a

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?