Which type of muscle is striated?
a skeletal
b smooth
c cardiac
d both a an...
![subject](/tpl/images/cats/biologiya.png)
![ansver](/tpl/images/cats/User.png)
Answers: 3
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Other questions on the subject: Biology
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 08:00, antoinewill05
Pls in your opinion, what are the limiting factors that might affect the growth or diversity of our ecosystem? respond to this question in claim, evidence, reasoning format. 1. make your claim (i are the limiting factors that might affect the growth or diversity of our 2. follow the claim with 3 pieces of evidence. evidence may be taken from the reading, the videos, previous lessons, or googled answers. site sources, too. 3. use reasoning to explain why you chose your evidence.
Answers: 3
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 09:00, crazteeyn8290
What happens when water’s salinity increases? mass decreases. freezing point decreases. buoyancy of objects decreases. the amount of dissolved minerals decreases.
Answers: 2
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 10:30, Xavitheking2542
In order to study genetic mutations, scientists must study genetic material. which statement describes the genetic material scientists are most likely studying? a) they study alleles that contain chromosomes, which are rna. b) they study alleles that contain genes, which are chromosomes. c) they study chromosomes that contain genes, which are dna segments.
Answers: 1
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Questions in other subjects:
![Konu](/tpl/images/cats/mat.png)
Mathematics, 20.09.2020 08:01
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/mat.png)
Mathematics, 20.09.2020 08:01
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/fizika.png)
Physics, 20.09.2020 08:01
![Konu](/tpl/images/cats/health.png)
![Konu](/tpl/images/cats/fizika.png)
Physics, 20.09.2020 08:01
![Konu](/tpl/images/cats/en.png)
![Konu](/tpl/images/cats/fizika.png)
![Konu](/tpl/images/cats/mat.png)
Mathematics, 20.09.2020 08:01