Based on the gene and protein sequences that follow, what type of mutation has occurred and what is the effect on the polypeptide?
a. Normal gene: ATGGCCGGCCCGAAAGAGACC
b. Mutated gene: ATGGCCGGCACCGAAAGAGACC
c. Normal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr
d. Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp
Answers: 1
Biology, 21.06.2019 22:00, sophiateaches053
Drag each label to the correct location. each label can be moved more than once match the properties with the subatomic particle
Answers: 3
Biology, 22.06.2019 06:30, paytonpaige22
Brainliest ! is slowing down a car an example of acceleration? explain. - explain correctly
Answers: 1
Biology, 22.06.2019 09:00, idk8348
The blue particles in this image are able to cross the cell membrane through simple diffusion. how will they be transported? outside the cell inside the cell o a. the substances will move directly across the membrane from outside the cell to inside the cell. b. the substances will move through channels in the membrane proteins from outside the cell to inside the cell. o c. the substances will move through channels in the membrane proteins from inside the cell to outside the cell. o d. the substances will move directly across the membrane from inside the cell to outside the cell.
Answers: 2
Based on the gene and protein sequences that follow, what type of mutation has occurred and what is...
Chemistry, 29.03.2021 17:40
History, 29.03.2021 17:40
Mathematics, 29.03.2021 17:40
Mathematics, 29.03.2021 17:40
Mathematics, 29.03.2021 17:40