Biology, 17.03.2020 01:18 kraigstlistt
Given that the sequence of nucleotides in a DNA strand will be used to produce an mRNA strand that will then code for a protein, mutations in the DNA can affect the final product. Depending on the severity of the mutation, the protein can range from not being affected to being rendered completely nonfunctional, especially if the reading frame is altered. Which of the following represents a change in reading frame if the template strand of DNA reads as follows?
A) AGCTGGACTTTAGACAAG
B) AGCTGGACTTTAGACAAG
C) AGCTGGACTTGAGTGAACAAG
D) AGCTGGACTATAGACAAG
E) AGCUGGACUUUAGACAAG
F) AGCTGCGACTTTAGACAAG
Answers: 1
Biology, 21.06.2019 17:20, Ap621765
Joe is breeding cockroaches in his dorm room. he finds that the average wing length in his population of cockroaches is 4 cm. he chooses the six cockroaches that have the largest wings; the average wing length among these selected cockroaches is 10 cm. joe interbreeds these selected cockroaches. from earlier studies, he knows that the narrow-sense heritability for wing length in his population of cockroaches is 0.6. a. calculate the selection differential and expected response to selection for wing length in these cockroaches. b. what should be the average wing length of the progeny of the selected cockroaches?
Answers: 1
Biology, 21.06.2019 20:00, gracethegreat1
Surrounded by microtubules, located near the nucleus. (don't try to google it) (give answer only if u know)
Answers: 1
Biology, 21.06.2019 20:10, saabrrinnaaa
Growth of chest hair, deepening of the voice, and muscle growth are secondary sex characteristics. which most likely affects the development of these traits? testes ovaries prostate gland vulva
Answers: 3
Biology, 22.06.2019 03:00, elishaheart21
Which statement best describes the relationship between an allele and a gene? question 1 a. an allele is a variation of a gene that can be expressed as a phenotype. b. an allele is the part of a gene that attaches to messenger rna molecules. c. an allele is a segment of a dna molecule that controls replication of a gene.
Answers: 3
Given that the sequence of nucleotides in a DNA strand will be used to produce an mRNA strand that w...
Mathematics, 18.01.2022 04:30
History, 18.01.2022 04:30
English, 18.01.2022 04:30
Mathematics, 18.01.2022 04:30
Social Studies, 18.01.2022 04:30
Mathematics, 18.01.2022 04:30