![subject](/tpl/images/cats/biologiya.png)
Biology, 10.03.2020 08:08 OrionGaming
Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature (tm) of 59 8C. If an RNA duplex oligonucleotide of identical sequence (sub-stituting U for T) is constructed, will its melting temperature be higher or lower?
![ansver](/tpl/images/cats/User.png)
Answers: 3
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Other questions on the subject: Biology
![image](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 13:30, cjacobs77311
Awic dietitian is meeting with a client who has an infant and a young child. the mother says that the young child is a very picky eater and will only eat crackers and juice. the health worker notices that the child's hair is brittle, his nails tear easily, and the skin inside his lower eyelids is very pale. these are all signs of iron deficiency.
Answers: 3
![image](/tpl/images/cats/biologiya.png)
![image](/tpl/images/cats/biologiya.png)
You know the right answer?
Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequ...
Questions in other subjects:
![Konu](/tpl/images/cats/obshestvoznanie.png)
![Konu](/tpl/images/cats/mat.png)
Mathematics, 05.06.2021 14:00
![Konu](/tpl/images/cats/en.png)
English, 05.06.2021 14:00
![Konu](/tpl/images/cats/en.png)
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/en.png)
English, 05.06.2021 14:00
![Konu](/tpl/images/cats/biologiya.png)
![Konu](/tpl/images/cats/istoriya.png)
History, 05.06.2021 14:00
![Konu](/tpl/images/cats/en.png)
English, 05.06.2021 14:00
![Konu](/tpl/images/cats/istoriya.png)
History, 05.06.2021 14:00