CAN SOMEBOdy explain this to me PLEASE!!

When transcribing DNA into RNA, you just flip the letters to the opposites.  But because Thymine isn't in RNA, you convert all the A's in the sequence into U, and all the T's into A.  

I didn't do your problem, but here:

Ex: ATTAGCTATCGTCGATAGGG

Step 1: break the sequence into codons, or 3 at a time.

ATT   AGC  TAT  CGC  CCC  TCG  ATA  GGG

Step 2: Convert the codons to get your transcription of RNA.

UAA UCG  AUA  GCG  GGG  AGC  UAU  CCC

Step 3: look at you chart, and in the order the new codons go in to get your genetic message.

Step 4: You're done!

Step 5: Congratulations, you learned something.

Explanation:

hope this helped

answer: mannn ion even know fam

explanation: just try asking yoo teacher yo parents or just simply another sight

regents of the university of california v. bakke, 438 u.s. 265 (1978), was a landmark decision by the supreme court of the united states. it upheld affirmative action, allowing race to be one of several factors in college admission policy.