We have done a nutrient recovery experiment for Hec and Trp. Below are the growth results of plating nine colonies on plates containing different media compositions.

MINIMAL MEDIA: 1, 3, 5, 8
+Hec: 1, 3, 4, 5, 7, 8
+Trp: 1, 2, 3, 5, 8, 9
+Hec +Trp: 1, 2, 3, 4, 5, 6, 7, 8, 9

Indicate which colonies have a loss of function mutation for the given genotypes. When filling in the blank, use the colony numbers in numerical order separated by commas only. No spaces. For example in the box enter: 1,2,6,10

Mutant Genotype Colony(ies)
Hec-
Trp-
Hec- & Trp-

Common symptoms of an iron-defiency anemia include muscle weakness shortness of breath and lightheadedness why does iron deficiency causes these symptoms

Fruit bats in central america eat bananas and other fruits. banana plants rely on bats for pollination. what would be the most likely consequence on the banana crop if fruit bats were eliminated from the area? the banana crop would increase because bats would stop eating the crops. the banana crop would decrease because bats would no longer pollinate the crops. the banana crop would remain constant because bees would replace the bats. the banana crop would remain constant because the plants would adapt using asexual reproduction.

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?