Below are the DNA sequences that encode the first eight amino acids for four alleles of the Adh protein in Drosophila melanogaster. Nucleotides that differ from the first sequence are shown by a lowercase letter.

ATGTCTCTCACCAACAAGAACGTC

ATGgCTCTCACCAACAAGAACGTC

ATGTCgCTCACCAACAAGAACGTC

ATGTCTtTgACCAACAAGAACGTC

a. What are the first eight amino acids for each of these four DNA sequences?

b. For each of the four polymorphic sites, indicate whether the site represents a synonymous or nonsynonymous polymorphism.

c. Synonymous polymorphisms tend to be more common than nonsynonymous ones. Why might that be?

starchy vegetables are high in carbohydrates.

starchy vegetables contain more carbohydrates than non-starchy vegetables.

explanation:

there are two primary categories of carbohydrates, essentially differentiated on the basis of their carbohydrate content (which is in the form of starch - a complex carbohydrate):

those vegetables which contain little amounts of starch are termed as non-starchy vegetables, and some examples include: artichokes, broccoli and bean sprouts.

vegetables high in their starch content are distinguished as starchy vegetables, and some examples include: potatoes, chickpeas and corn.

that is true   : ) hope this you

the answer is a) cell division.

hope this !