subject
Biology, 14.02.2020 00:09 luckylady

Most plants and animals require food and oxygen to live. Plants and animals primarily use the oxygen to convert their food into A. Cells. B. Blood. C. Carbon dioxide. D. Energy.

ansver
Answers: 1

Other questions on the subject: Biology

image
Biology, 21.06.2019 22:50, teresaswinger
An organism has the following traits multicellular cant photosynthesize has a skull. wht kingdom does this organism most likely belong too?
Answers: 1
image
Biology, 22.06.2019 09:30, maggie123456751
Hemoglobin is a proton that carries oxygen around the body what is hemoglobin made from
Answers: 1
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
image
Biology, 22.06.2019 13:00, micknero
What is the role of dna ligase in the elongation of the lagging strand during dna replication?
Answers: 1
You know the right answer?
Most plants and animals require food and oxygen to live. Plants and animals primarily use the oxygen...

Questions in other subjects:

Konu
Social Studies, 04.08.2019 03:00
Konu
Biology, 04.08.2019 03:00