Biology, 10.02.2020 21:09 jjjjj23407

In the US, there are existing state laws to protect individuals from genetic discrimination in what areas? Select all that apply.

insurance companies
in the work place
criminal investigations
in the hospital or clinic
kids sport teams
government agencies

Answers: 1

Show answers

Other questions on the subject: Biology

Biology, 21.06.2019 22:00, vegeta8375

(drag each tile to the correct identify which questions can be answered by what can be answered by science or which cannot. -is it right or wrong to use genetic engineering to produce new food products? -what are the most common social settings that tend to produce accomplished artists? -if a new gene is added to the genome of a tomato species, will that species be more resistant to insects? -should humans use biotechnology to bring extinct organisms from the fossil record back to life? -do the types of organisms found in the fossil record appear in consistent sequences in different parts of the world? -are michelangelo's paintings more impressive than rembrandt's?

Answers: 3

continue

Biology, 22.06.2019 04:00, Mw3spartan17

1) strawberry plants typically reproduce by making runners, which are miniature versions of themselves, that grow off of the roots and stems of the parent. this type of vegetative reproduction is known as a) pollination. b) fragmentation. c) binary fission. d) vegetative propogation.

Answers: 2

continue

Biology, 22.06.2019 11:00, greciakawaii

2. which of the following statements does not accurately describe stem cells? a. embryonic stem cells make up the inner cell mass of a blastocyst. b. with more research, stem cells may be used to repair or replace damaged cells. c. the use of stem cells is without any objections since it can be used in therapies to humans. d. adult stem cells are multipotent and can differentiate into many types of cells.

Answers: 1

continue

Biology, 22.06.2019 12:00, jose200144

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Answers: 1

continue

You know the right answer?

In the US, there are existing state laws to protect individuals from genetic discrimination in what...