![subject](/tpl/images/cats/biologiya.png)
Biology, 18.01.2020 03:31 valoiserika1229
Whereas some modern whales possess a small and useless pelvis, linking modern whales to their four-legged evolutionary ancestors possess a larger and even functional pelvis.
![ansver](/tpl/images/cats/User.png)
Answers: 3
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Other questions on the subject: Biology
![image](/tpl/images/cats/biologiya.png)
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 08:00, notseansafe
This is a situation in which genes are attached to an organism's sex chromosomes; the sex of an organism influences the expression of a gene.
Answers: 2
![image](/tpl/images/cats/biologiya.png)
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Whereas some modern whales possess a small and useless pelvis, linking modern whales to their four...
Questions in other subjects:
![Konu](/tpl/images/cats/pravo.png)
Law, 18.06.2021 14:30
![Konu](/tpl/images/cats/geografiya.png)
Geography, 18.06.2021 14:30
![Konu](/tpl/images/cats/himiya.png)
![Konu](/tpl/images/cats/biologiya.png)
Biology, 18.06.2021 14:30
![Konu](/tpl/images/cats/mat.png)
Mathematics, 18.06.2021 14:30
![Konu](/tpl/images/cats/informatica.png)
![Konu](/tpl/images/cats/User.png)
![Konu](/tpl/images/cats/en.png)
English, 18.06.2021 14:30
![Konu](/tpl/images/cats/istoriya.png)
History, 18.06.2021 14:30
![Konu](/tpl/images/cats/en.png)
English, 18.06.2021 14:30