Biology, 11.12.2019 18:31 grayjasmine46

Denaturation of nucleic acids a duplex dna oligonucleotide in which one of the strands has the sequence taatacgactcactataggg has a melting temperature (tm) of 59 °c. if an rna duplex oligonucleotide of identical sequence (substituting u for t) is constructed, will its melting temperature be higher or lower?

Answers: 1

Show answers

Other questions on the subject: Biology

Biology, 22.06.2019 01:50, Nikida41

What are the two main phases of a cell cycle

Answers: 2

continue

Biology, 22.06.2019 02:00, naomicervero

Select the correct answer from each drop-down menu. in an experiment, dr. travis examined the effects of calcium intake on osteoporosis, a condition that causes an increased risk of bone fractures. the amount of calcium is variable. the risk of bone fractures .

Answers: 3

continue

Biology, 22.06.2019 14:30, me1233456

All annelids and arthropods have a blank body plan . unlike annelids, arthropods also have blank . the circulatory system of annelids is blank , while circulatory system of arthropods is blank .

Answers: 3

continue

Biology, 22.06.2019 19:30, ayoismeisalex

Karen is a forensic scientist whose purpose is to identify and evaluate physical evidence. which of the following tasks does she perform? a. reporting results of scientific analysis b. interviewing suspects c. questioning witnesses d. preparing victims for burial

Answers: 1

continue

You know the right answer?

Denaturation of nucleic acids a duplex dna oligonucleotide in which one of the strands has the seque...