an aquatic arthropod called a cyclops had antennae that are either smooth or barbed. the allele for barb's (b) is dominant over smooth (bb). in the same organism non-resistance to pesticides (n) is dominant over resistance to pesticides (nn). make a "key" to show all possible genotypes and phenotypes of this organism.

What is the term for the two sets of chromatids formed in the parent cell a. haploid b. diploid c. gamete d. tetrad

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Abody cell has been growing and at synthesis proteins. in the nucleus of this body cell, dna replication is taking place. and a copy of the cells genetic material is copied. which of the following is the best conclusion you can make about the life cycle of this cell ? a) the cell is ready to undergo mitosis. and a chemical signal will send the cell to prophase b)the cell is undergoing meiosis and will cross over the genetic material next c)the cell is in the s phase of interphase and will move next to the g2 phase d) the cell is in the g2 phase of the interphase and is ready to begin diving