subject
Biology, 03.12.2019 21:31 issaicnotisaac

What is an advantage of using pluripotent cells instead of multipotent cells in
medical treatments?

ansver
Answers: 1

Other questions on the subject: Biology

image
Biology, 21.06.2019 22:00, lazavionadams81
Which of the following scenarios is an example of the bottleneck effect? answers a in south africa, much of the afrikaner population is descended from a small number of dutch colonists. in this population, this is an unusually high frequency of pseudoxanthoma elasticum (pxe), an elastic tissue disorder. b four white-tailed deer are introduced to a park in finland. thirty years after their introduction scientists compare the genes in the population and find that there is no variation. c during the industrial revolution, london's air became filled with soot. as a result, birds started eating more of the lighter moths because they were easier to spot than their darker counterparts. over time, the moth population changed so that there were more darker moths than lighter ones. d 10% of the population of american alligators in an area have the recessive trait albinism. a massive flood results in the death of 80% of the population. of the remaining population, 60% have the recessive trait of albinism.
Answers: 2
image
Biology, 22.06.2019 00:20, sam9350
The buildup of sediments where a river empties into a slow-moving or nonmoving body of water is known as a/an
Answers: 1
image
Biology, 22.06.2019 10:30, jagslovegirl
Natural selection changes allele frequencies because some survive and reproduce more successfully than others.
Answers: 1
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
What is an advantage of using pluripotent cells instead of multipotent cells in
medical treatm...

Questions in other subjects:

Konu
Business, 14.12.2021 23:20