You performed a sanger sequencing reaction and obtained the following electropherogram (a computer-generated trace of the intensity of each color's fluorescence). in this figure, a = green, c = purple, g = black, t = red. the height of the peaks is unimportant. the 5' end of the sequence is at the left of the trace.

what is the sequence of the template dna used for this sequencing reaction?

a.

5' tttgctttgtgagcggataacaa 3'

b.

3' tttgctttgtgagcggataacaa 5'

c.

5' aaacgaaacactcgcctattgtt 3'

d.

5’ ttgttatccgctcacaaagcaaa 3’

e.

3' aaacgaaacactcgcctattgtt 5'

can someone with this? i can never get more than 3/5 right:

match the following terms with their descriptions below.

question selected match
used to detect close or exact complementarity to a probe sequence

c.
high stringency

used in identifying a specific mrna from a mixture

a.
northern blot

used to quantitate the initial template concentration of an unknown relative to a standard template of known concentration

b.
template dna

reliant upon dna mismatch repair

d.
site-directed mutagenesis

refers to the sequence of interest within the sample in a pcr reaction

e.
cycle threshold method (ct)

As , plants meet their needs for making food from air, soil, water, and the sun's energy in a process called there are plants called grow high in trees without here are words to put in the blanks. 1.) producers 2.) consumers 3.) chloroplasts 4.) epiphytes

Many animals cannot sweat to maintain a stable body temperature. what is one other way animals can cool down?

Rease is an enzyme used by plants to break down urea (a nitrogen-containing compound) into carbon dioxide and ammonia. urease urea > > > carbon dioxide and ammonia ammonia is broken down by plants into a nitrogen source plants need to grow. thus, plants could not use urea as a nitrogen source unless it was first converted to ammonia. in soybean plants there are two different kinds of urease, one produced in the seeds and the other produced in the leaves of the plant. three types of soybean plants were used in a set of experiments: normal soybeans and two mutant strains, one lacking the urease in the seeds only (strain 1) and one lacking urease in the leaves only (strain 2). experiment 1 separate areas in a field were planted with normal, strain 1, and strain 2 soybeans. all types of soybeans appeared to grow, flower, and produce seeds equally well. there were no externally detectable differences among the strains. experiment 2 small pieces of plant leaves of equal weight were obtained from each type of soybean plant and separately placed on media in culture dishes. tissue growing in this way will become an unorganized clump of cells referred to as callus. to provide a controlled nitrogen source, half the tissue samples of each type were placed on media containing urea, and the other half of the samples were placed on media containing ammonia. after 30 days, the weight gain for each of the callus samples was determined. results are shown in the table below.