Biology, 18.11.2019 12:31 juicecarton

Protein synthesis and mutation cer practice
what is the type of mutation that has occurred in this sequence and its
significance?
original dna sequence: ctgcacctgactcctgaggag
mutated dna sequence: ctgcacctgactcctgggag
claim:

Answers: 2

Show answers

Other questions on the subject: Biology

Biology, 21.06.2019 19:30, whrjegt4jrnfdvj

Sarah is sitting at the top of the slide in the schools playground. which will increase sarah’s kinetic energy a- an additional child is added to the top of the slide. b- sarah is pushed and moves down the slide. c- sarah climbs down the ladder and off the slide. d- the ladder is moved to the other side of the yard.

Answers: 1

continue

Biology, 22.06.2019 04:30, jillericamurph46

The nursing instructor has been observing nursing students initiate an iv infusion. which action(s), if made by the nursing student, indicates that further instruction is needed? (select all that apply.) the nursing student:

Answers: 1

continue

Biology, 22.06.2019 05:00, Goldenstate32

2. if someone had the list of traits you provided in question 1, do you think he or she would be able to find you in a group of 1000 people? why or why not? if not, what other information encoded in your genes might distinguish you from the others in the group? what are other traits that are encoded for by dna?

Answers: 3

continue

Biology, 22.06.2019 12:30, asheeee58

This is the interaction of two organisms where one is and the other is neither nor harmed.

Answers: 1

continue

You know the right answer?

Protein synthesis and mutation cer practice
what is the type of mutation that has occurred in...