![subject](/tpl/images/cats/biologiya.png)
Biology, 16.12.2019 19:31 ginalopez567
What is the difference between an organ and an organalle
![ansver](/tpl/images/cats/User.png)
Answers: 2
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Other questions on the subject: Biology
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 20:20, asco0317p34v1s
What is the purpose of transcription? a. to copy the nucleotide in dna b. to form rna molecules from dna c. to produce a nucleic acid sequence from an amino acid sequence d. to link amino acids together to form stands of protein
Answers: 2
![image](/tpl/images/cats/biologiya.png)
Biology, 23.06.2019 00:20, maiahfogel1351
Which activity occurs during the process of photosynthesis?
Answers: 1
![image](/tpl/images/cats/biologiya.png)
Biology, 23.06.2019 01:30, dillondelellis2006
Sarah and john are having a discussion on genetic diversity. sarah believes that it happen over a long period of time. john it happens immediately. who is correct? a. sarah is correct because genetic diversity occurs over a long period of time. b. john is correct because genetic diversity occurs immediately. c. both are correct because genetic variation can occur or long period of time. d. neither are correct because genetic diversity occurs over any period of time
Answers: 3
You know the right answer?
What is the difference between an organ and an organalle...
Questions in other subjects:
![Konu](/tpl/images/cats/istoriya.png)
![Konu](/tpl/images/cats/istoriya.png)
History, 30.08.2019 08:30
![Konu](/tpl/images/cats/mat.png)
Mathematics, 30.08.2019 08:30
![Konu](/tpl/images/cats/istoriya.png)
![Konu](/tpl/images/cats/health.png)
Health, 30.08.2019 08:30
![Konu](/tpl/images/cats/mat.png)
Mathematics, 30.08.2019 08:30
![Konu](/tpl/images/cats/fizika.png)
![Konu](/tpl/images/cats/fizika.png)
![Konu](/tpl/images/cats/biologiya.png)
![Konu](/tpl/images/cats/informatica.png)
Computers and Technology, 30.08.2019 08:30